Miklós Kásler - Zoltán Szentirmay (szerk.): Identifying the Árpád Dynasty Skeletons Interred in the Matthias Church. Applying data from historical, archaeological, anthropological, radiological, morphological, radiocarbon dating and genetic research (Budapest, 2021)

CHAPTER EIGHT – PCR and NGS investigations

13 motif: AAGGAAAG-AAGGTAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG-AGAGAG 12 motif: AAGGAAAG-AAGGTAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG-AGAGAG The sequencing data for Béla III were much harder to evaluate, because the M3 sample contained 13 and 15 allele genotypes, while sample M4 contained 11 and 13. Short and long repetitions only occurred in a small percentage and could be classified as PCR artifacts. The accepted final genotype is 13/13. Sample M3, motif 15 (coverage 21): AAGGAAAG-AAGG TAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG­AGAGAGGAAGAAAGAGAGAAGATTTTTATTCGGGTAATGGGTGC Sample M4, motif 13 (coverage 2083): AAGGAAAG-AAGG TAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AAGG AGAGAGGAAGAAAGAGAGAAGATTTTTATTCGGGTAATGGGTGC Based on the above, we can conclude that the number of A2 repeating sequences of the skeletons 11/52 and Béla III are the same, 13 motif. 163

Next

/
Thumbnails
Contents