Dr. Murai Éva - Gubányi András szerk.: Parasitologia Hungarica 31. (Budapest, 1998)
9600 thermal cycler (Roche Diagnostic Systems, F. Hoffmann-La Roche Ltd., Basle, Switerland). In the initial amplification the Pl and P2 primers amplified a 194 bp product and the nested reaction produced a 97 bp product with a P3 and P4 primers. Half pi aliquots of previously amplified samples were added to a second PCR mixture (nested PCR) where only the primers PI and P2 were replaced by the primers P3: 5'- TGCATAGGT TGCCAGTCACTG -3' (757-776 nucleotides) and P4: 5'GGCGACCAATCTGCGAATAC ACC -3' (853-831 nucleotides) (Fuentes et al. 1996). The final reagent concentrations were the same as described previously with a final volume of 50 pi (Fuentes et al. 1996). The nested PCR amplification protocol during 20 cycles was the following: 93 0 C for 1 minute, 55 0 C for 1.5 minutes, 72 0 C for 3 minutes with a terminal extension at 72 0 C for 10 minutes. Standard precautions were employed to prevent contamination (Innis et al. 1990). Detection of amplified products was carried out by 2% w/v agarose gel (LKB Produkter AB, Bromma, Sweden) electrophoresis followed by ethidium bromide (1 pg/ml) staining and UV transillumination evaluation (Cingolani et al. 1996). RESULTS The results of our very first PCR experiment are shown in Figures 1 and 2. Only the expected 194 and 97 bp amplified products were detected after the first step PCR and second nested PCR, respectively. A positive control (lane 2) and two samples (lanes 3 and 4) show a 197 bp long T. gondii Bl gene specific product. Four samples (lanes 5 to 8) and the negative control (lane 9) do not contain a specific band seen on Fig. 1. On Figure 2, besides lanes 2, 3 and 4, two more samples (lanes 5 and 6) show positivity and carry a 97 bp long T. gondii DNA sequence after the second amplification step. Fragments of the molecular weight marker are shown on both Figures 1 and 2 (lanes 1 and 10). All the 33 asymptomatic newborns of mothers suspected of having acute toxoplasmosis possessed CF titres from 1:256 to 1:2048 similar to their mothers' CF titres without anti-P30 IgM and IgA antibodies (Table 1.). Only two out of the examined 33 urine samples showed the Toxoplasma-speciüc PCR product after the first-step PCR and 14 more Table 1 Results of the PCR in urine samples and the serological tests of asymptomatic newborns suspected having become infected with Toxoplasma gondii during intrauterine life PCR results (urine) Serological tests (sera) No. of samp. PCR Nested PCR Anti-P30 IgA IgM CFT (Fuentes et al.) (Sanofi Diagnostics Pasteur) (SEVAC) + + + + + 2 2 0 2 0 0 2 0 2 2 0 14 0 14 14 c 0 14 c 14 14 0 17 0 17 0 17 0 17 0 17 17 0 Total (33) 2 31 16 17 0 33 0 33 33 0
