Hidrológiai Közlöny 2008 (88. évfolyam)

6. szám - IL. Hidrobiológus Napok: „A Balaton és vízrendszere – a Balaton-kutatás története” és „A Duna-kutatás története” Tihany, 2007. október 3–5.

49 Irodalom Altschul, S.F., TL. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller, DJ. Lipman (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. - Nucleic Acid Res. 25: 3389-3402. Callieri, C, E. Amicucci, R. Bertoni, L. Vörös (1996) Fluorometric characterization of two picocyanobacteria strains from different underwater light quality. - Int. Revue ges. Hydrobiol. 8: 13-23. Crosbie, N.D., M. Pöckl, T. Weisse (2003) Dispersal and phylogenetic diversity of nonmarine picocyanobacteria, inferred from 16S rRNA gene and c/>c Ä/f-intcrgenic spacer sequence analyses. - Appl. Environ. Microbiol. 69: 5716-5721. Daley, R.J., J.E. Hobbie (1975) Direct counts of aquatic bacteria by a modified epifluorescence technique. - Limnol. Oceanogr. 20: 875882. Ernst, A., S. Becker, U.I. Wollenzien, C. Postius (2003) Ecosystem-dependent adaptive radiations of picocyanobacteria interred from 16S rRNA and ITS1 sequence analysis. - Microbiology 149: 217-288. Felföldi, T., B. Somogyi., M. Nikolausz, K. Márialigeti, L. Vörös (2007) Molecular analysis of freshwater picocyanobacterial isolates from Hungary. - Kézirat. Mózes, A., M. Présing, L. Vörös (2006) Seasonal dynamics of picocyanobacteria and picoeukaryotes in a large shallow lake (Lake Balaton, Hungary). - Int. Rev. Hydrobiol. 91: 38-50. Mózes A., Vörös L. (2004) Különleges pikoplankton együttesek a befagyott Balatonban. - Hidrol. Közi. 84: 180-182. Niibel, U„ F. Garcia-Pichel, G. Muyzer (1997) PCR primers to amplify 16S rRNA genes from cyanobacteria. - Appl. Environ. Microbiol. 63: 3327-3332. Robertson, B.R., N. Tezuka, M.M. Watanabe (2001) Phylogenetic analyses of Synechococcus strains (Cyanobacteria) using sequences of 16S rDNA and part of the phycocyanin operon reveal multiple evolutionary lines and reflect phycobilin content. - Int. J. Syst. Evol. Microbiol. 51: 861-871. Somogyi B., Vanyovszky J., Agyi A., Vörös L. (2007) Eukarióta és prokarióta pikoalga törzsek fotoszintézisének összehasonlító vizsgálata. - Hidrol. Közi. 87: 119-121. Stockner, J.G. (1988) Phototrophic picoplankton: An overview from marine and freshwater ecosystems. Limnol. Oceanogr. 33: 765-775. Tamura, K, J. Dudley, M. Nei, S. Kumar (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. Turner, S„ K.M. Pryer, V.P.W. Miao, J.D. Palmer (1999) Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. - J. Eukaryot. Microbiol. 46: 327-338. Urbach, E„ DJ. Scanlan, DL. Distel, J.B. Waterbury, S.W. Chisholm (1998) Rapid diversification of marine picophytoplankton with dissimilar light-harvesting structures inferred from seguences of Prochlorococcus and Synechococcus (Cyanobacteria). - J. Mol. Evol. 46: 188-201. Vanyovszki J., Fodorpataki L„ Agyi A., Somogyi B., Vörös L. (2008) Prokarióta és eukarióta pikoalgák fotoszintézisének pH és szalinitás függése - Hidrol. Közi. (ezen száma) Vörös, L., P. Gulyás, J. Németh (1991) Occurance, dynamics and production of picoplankton in Hungarian shallow lakes. - Int. Revue ges. Hydrobiol. 76: 617-629. Wetzel, R.G., Likens, G.E. (1991) Limnological Analyses. 2nd Ed. Springer-Verlag, New York Wood, A.M., P.K. Horan, K. Muirhead, D A. Phinney, C.M. Yentsch, J.B. Waterbury (1985) Discrimination between types of pigments in marine Synechococcus spp. by scanning spectroscopy, epifluorescence microscopy and flow citometry. - Limnol. Oceanogr. 30: 1303-1315. 1. táblázat. A pikoalga vizsgálatokban alkalmazott PCR primerek szekvenciája primer szekvencia specifitás referenda CYA106F CGGACGGGTGAGTAACGCGTGA pro- és eukarióta algák Niibel és mtsai, 1997 CYA 781R GACTACWGGGGTATCTAATCCCWTT pro- és eukarióta algák Niibel és mtsai, 1997 cpcBF TAGTGTAAAACGACGGCCAGTTGYYTKCGCGACAT GGA pikofitoplankton klád (Synechococcus

/ Cyanobium) Robertson és mtsai, 2001 cpcAR TAGCAGGAAACAGCTATGACGTGGTGTARGGGAA YTT pikofitoplankton klád (Synechococcus

/ Cyanobium) Robertson és mtsai, 2001 2. táblázat. Az egyes Synechococcus csoportok (OTU-k) arányainak összefüggése a klorofill-a koncentrációval és a hőmérséklettel (vastagon szedve a ±0,5-et meghaladó, szignifikánsnak tekintett korrelációs együttható értékei) Keszthelyi-medence Siófoki-medence klorofill-a hőmérséklet klorofill-a hőmérséklet OTU1 0,14 OTU2 0,17 0,98 0,14 0,92 OTU3 -0,59 -0,87 -0,16 -0,84 OTU4 -0,05 -0,29 OTU5 0,91 0,41 -0,18 -0,78 OTU6 -0,01 0,97 -0,08 0,94 OTU7 -0,45 -0,75 -0,10 -0,47 OTU8 -0,37 0,63 OTU9 0,49 0,48 OTUIO 0,98 0,33 -0,07 OTU11 0,96 0,27 OTU12 0,45 0,23 Investigations on the diversity of picoalgae in Lake Balaton with molecular methods Duleba, M.', Felföldi, T.', Somogyi, B.

2, Vajna, B.', Vörös, L.

2, Márialigeti, K.' bstract: Photoautotrophic picoplankton is a wide-spread community of bacterial-sized organisms, which can provide as much as 50 percent of primary production in Lake Balaton. Identification of picoplankton organisms on the basis of classical methods is not possible in most cases because of their small size (< 2 pm) and the lack of distinct morphological characters. Therefore molecular methods are more suitable to investigate their diversity. Water samples taken from Lake Balaton were investigated using PCR-based methods (cloning and sequence analysis, length polymorphism analysis). Primers specific to 16S rDNA of cyanobacteria and plastids of eukaryotic algae were used for cloning. Phycocyanin operon (intergenic spacer with different length between cpcA and cpcB) specific to picocyanobacteria was amplified for length polymorphism examination. Our results showed that in Lake Balaton picoalgae form a more diverse community than it was previously thought based on cultivation studies and epiflourescence microscopy. We detected seasonal and spatial changes in the community and the abundance of some picocyanobacterial groups correlated with the changes in temperature and chlorophyll-a concentration. Keywords: photoautotrophic picoplankton, Lake Balaton, 16S rDNA, phycocyanin opreon, cloning and sequence analysis, length polymorphism.