O. Merkl szerk.: Folia Entomologica Hungarica 68. (Budapest, 2007)

Scolytidae belongs to - was published eleven years ago by PODLUSSÁNY (1996). He listed altogether 105 bark and ambrosia beetles for Hungary. Some more detailed investigations were made on some forestry related, or damage causing species (LAKATOS 2006). However, it doesn't mean, that no new arrivals were recorded for the last 50 years. Some recent examples are: Xyleborus affinis ElCHHOFF, 1868, which were introduced to Hungary with Dracaena live stocks (TUSNÁDI &c MERKL 1991); Phloeosinus aubei {FERRIS, 1855) and P. thujae (PERRIS, 1855) which expanded their natural Mediterranean distribution area to Hungary (RAKK & BÜRGÉS 1994); and/ps amitinus (ElCHHOFF, 1871) and Carphoborus minutus (FABRICIUS, 1798), which were found first during detailed investigation of the Hungarian forests (LAKATOS 2006). In 2005 we have found a further species. The importance of Xylosandrus germanus (BLANDFORD, 1894) is highlighted by the fact that both on his native distribution area (Asia) and in North-America (where it was introduced in the early 20th century) the species is considered as an important pest. The aim of our investigations was (1) to confirm the presence of X. germanus in Hungary using morphological characters and genetic markers, and (2) to evaluate the importance and hazard of the species for the Hungarian forestry. MATERIALS AND METHODS Sample collection - Individuals of X. germanus were collected in Hungary (Nagymáté, Baranya county; N: 46° 11' 10.78" E: 17° 58' 35.56"). Altogether four beetles were excavated from felled Quercus and Tilia logs, on the 31 May 2005 by F. LAKATOS and H. KAJIMURA; and further 32 specimens were reared from the attacked logs in light eclectors at the Institute. The prepared specimens are deposited in the Coleoptera Collection of the Hungarian Natural History Museum (Budapest) and at the Institute of Sylviculture and Forest Protection, University of West Hungary (Sopron). Further individuals were received from South Germany (Baden-Württemberg), collected by TOBIAS BEIGEI. (Table 1). Samples were placed into absolute ethanol and stored at -20 °C. Molecular analysis - Insect DNA was extracted using the GenElute" Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, USA) following the manufacturer's protocol. The extracted DNA was stored at 4 °C for up to 3 weeks, but for long term storage DNA was kept at -20 °C. The amplification of the DNA was carried out in 25 [U reactions containing 3.75 mM MgCl

2 125 \iM dNTPs (Sigma-Aldrich, USA), 0.5 ^M of the primers "Dick" 5'ccaacaggaattaaaatttttagatgattagc-3' (position: 2410-2441) and "Pat" 5' tccattgcactaatctgccatatta -3' (position: 3014-3039) (LUNT et al. 1996) and 1U of Promega Taq. The amplifications were carried with an initial denaturation step of 3 min at 94 °C, which was followed by 35 cycles of